Analogy/ Homology

1.      Homologous Trait Information:

A)    The two different species that possess the homologous trait of having scales are the American alligator and the American crocodile. The American alligator is a reptile that is part of the alligatoridae family of crocodilians. They live in freshwater lakes, marshes, swamps, and rivers. They have a round snout, a low lying body, and a body armor that consists of thick keeled scales that are large, dark, and green and grey in color. The scales, although tough, are also smooth and don’t have ridges. The American crocodile is a reptile that is part of the crocodylidae family of crocodilians. They are lighter in color and have a thinner, pointier snout than the American alligator. Their scales are more brown and grey in color and they also have rows of raised scales. They live in coastal lagoons, fresh water river estuaries, and mangrove swamps.

B)    The homologous trait of each species is having scales on their skin as a means of protection. American alligators use their scales as not only a means of protection from predators, but as a means of protection from the environment as well. Since they are low lying to the ground, their scales act as a barrier and help protect them from the roughness of the ground. American crocodiles use their scales to protect their internal organs from harm during fights with predators. They also use the size of their scales as a way to swim faster and more efficiently since the scales gives their tails a larger surface area. These traits exhibit differences in between the two species because of the species have adapted the use of their trait to their environment. For instance, a salt water crocodile will use their scales more for the protection from the salt water environment they live in where as an alligator living in a swamp that is highly populated by other alligators will use their scales more for protection from rival alligators.

C)    A common ancestor of these two species was the dinosaur. I know that the ancestor possessed this homologous trait because scientists have discovered fossils which have shown detailed imprints of the different sized scales found on their bodies. Having scales also protected them from even larger predators.

D)    The following are pictures of an American crocodile and an American alligator.

 

2. Analogous Trait Information:  

A)Two different species that possess the same analogous trait of releasing chemicals as a defense    mechanism are the octopus and the skunk. Skunks are small striped mammals that average the size of a common housecat. They have anal glands that are used for defensive purposes when they feel that predators are around. When they sense a predator or feel like they are in danger, their defense is to turn around and spray a horrible smelling oily liquid in the predator’s face. Although not toxic, this spray is enough to send them running. Octopuses are invertebrates which have no internal skeleton. They have several defenses when it comes to warding off predators which include camouflage, hiding, and inking. When they feel they are in danger and that a predator is near, they release a large cloud of black ink which allows them to escape. Although not fatal, it s thought that the ink might lessen the efficiency of ones sense of smell.

B)   The analogous trait that each species has is the ability to release chemicals as part of their defense mechanism. Both of these animals release a specific liquid chemical that will hopefully allow them to stun their prey and let them escape unharmed. The octopus releases a cloud of ink to block the view of its prey and the skunk releases a smelly oily liquid which will affects its prey’s smell and make it difficult for them to track them.

     

C)    Unfortunately, I could not find a common ancestor for these two species and therefore am not aware if one possesses the same analogous trait that they do.

D)    The following are pictures of a skunk and an octopus

Protein Synthesis: DNA molecule

Good luck decoding my DNA strand!

CATATACCAACCGAACGTTAGCCTGTGGCCGTTAATGACCTGTGTGTTTATCGAGA

Historical Influences

Charles Darwin’s thoughts on natural selection: “…favourable variations would tend to be preserved, and unfavourable ones to be destroyed. The result of this would be the formation of a new species.” (Jurmain, Kilgore, Trevathan, and Ciochon 36)


The person who I think had the most influence over Darwin’s development of his theory of Natural Selection is Jean- Baptiste Lamarck. When Darwin was studying at Edinburgh, he had professors who were Lamarck supporters, and this was an important period in Darwin’s life which “… was a formative  period in his intellectual development.” (Jurmain, Kilgore, Trevathan, and Ciochon 33) Jean Baptiste Lamarck was a naturalist whose contribution to the scientific community was an attempt to try to explain evolution by saying that there is a connection, or better yet a relationship between the environment and the species that live there. And because of this, he believed that if there was a dramatic change in the environment, it would cause the species that lived in it to adapt so that they could survive. For instance, he believed that if a species didn’t use an organ or appendage and it was basically unnecessary, the organ or appendage would just get smaller or disappear from the species. In addition, he believed that if a species “ began to use an organ more than they had in the past, it would increase in its lifetime.”  (http://evolution.berkeley.edu/evolibrary/article/_0/history_09)

The point most directly affected by Jean- Baptiste Lamarck’s work is:

v  If the environment changes, the traits that are helpful or adaptive to that environment will be different. Organisms with those new adaptive traits will have greater reproductive success than others and those new beneficial traits will spread, producing a change in the population. This is the process of natural selection, essentially the process of the natural environment selecting the organisms that will be most successful.


This point was influenced by Lamarck because he believed that if an animal adapted to its new environment, and became better in the process, it would immediately pass on its new traits to its offspring. This included the idea that a short necked giraffe could stretch while trying to reach food and pass on its newly acquired longer neck to its offspring. Although Darwin was influenced by Lamarck, he didn’t agree with this part of Lamarck’s theory. Darwin believed that if the long neck giraffes had an advantage over the short necked giraffes in terms of being able to find food, the long neck giraffes would have a better chance of surviving and would therefore pass on their long necks to future generations of giraffes.

I don’t believe that Charles Darwin could have developed his theory of natural selection without the influences and ideas of Jean- Baptiste Lamarck. Lamarck was the first person to make the connection between the fact that species and the environment were connected, and the fact that they were still changing and evolving. His attempt at trying to explain evolution was the basis for Darwin’s theory of natural selection.


The attitude of the church definitely affected Darwin and his eventual publication of his book On the Origin of Species. During this period of reform, some of the people who followed the ideas of Jean- Baptiste Lamarck were atheists. This lead the church to feel that if people started to believe in evolution, it would mean the beginning of the end for the church. This was even evident in Darwin’s own home with his relationship with his wife Emma who felt that  “his ideas [were] running counter to her strong religious convictions.” (Jurmain, Kilgore, Trevathan, and Ciochon 36) It was only when he thought that someone else was going to receive credit for his own theories that he hurried and published his work. After he published On the Origin of Species, there was immediately (but not surprising) a backlash and negativity felt from the church which continues to this day.